IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ wu-2006-4 mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease Mouse T cells; these were either "natural" TReg cells (CD4+ CD25+) or retrovirally transduced with (human) FOXP3. Cells were stimulated by PMA/Ionomycin. linchen@usc.edu Cell (0092-8674) 2006 Only protein-protein interactions imex curation wu-2006-2 FOXP3 controls regulatory T cell function through cooperation with NFAT. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu Cell (0092-8674) 2006 Only protein-protein interactions imex curation wu-2006-1 FOXP3 controls regulatory T cell function through cooperation with NFAT. in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu Cell (0092-8674) 2006 Only protein-protein interactions imex curation wu-2006-3 FOXP3 controls regulatory T cell function through cooperation with NFAT. in vitro In vitro crosslink cross-linking study crosslink predetermined predetermined participant predetermined Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu Cell (0092-8674) 2006 Only protein-protein interactions imex curation il2_mouse_gene Interleukin-2 Il2 Il-2 gene gene mouse Mus musculus Mouse foxp3_human Forkhead box protein P3 Scurfin FOXP3 IPEX JM2 protein protein human Homo sapiens Human MPNPRPGKPSAPSLALGPSPGASPSWRAAPKASDLLGARGPGGTFQGRDLRGGAHASSSSLNPMPPSQLQLPTLPLVMVAPSGARLGPLPHLQALLQDRPHFMHQLSTVDAHARTPVLQVHPLESPAMISLTPPTTATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPNPSAPRKDSTLSAVPQSSYPLLANGVCKWPGCEKVFEEPEDFLKHCQADHLLDEKGRAQCLLQREMVQSLEQQLVLEKEKLSAMQAHLAGKMALTKASSVASSDKGSCCIVAAGSQGPVVPAWSGPREAPDSLFAVRRHLWGSHGNSTFPEFLHNMDYFKFHNMRPPFTYATLIRWAILEAPEKQRTLNEIYHWFTRMFAFFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDELEFRKKRSQRPSRCSNPTPGP foxp3_mouse Forkhead box protein P3 Foxp3 Scurfin protein protein mouse Mus musculus Mouse MPNPRPAKPMAPSLALGPSPGVLPSWKTAPKGSELLGTRGSGGPFQGRDLRSGAHTSSSLNPLPPSQLQLPTVPLVMVAPSGARLGPSPHLQALLQDRPHFMHQLSTVDAHAQTPVLQVRPLDNPAMISLPPPSAATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPRSGTPRKDSNLLAAPQGSYPLLANGVCKWPGCEKVFEEPEEFLKHCQADHLLDEKGKAQCLLQREVVQSLEQQLELEKEKLGAMQAHLAGKMALAKAPSVASMDKSSCCIVATSTQGSVLPAWSAPREAPDGGLFAVRRHLWGSHGNSSFPEFFHNMDYFKYHNMRPPFTYATLIRWAILEAPERQRTLNEIYHWFTRMFAYFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDEFEFRKKRSQRPNKCSNPCP ctla4_mouse_gene Ctla4 gene gene mouse Mus musculus Mouse il2ra_mouse_gene Interleukin-2 receptor subunit alpha gene gene gene mouse Mus musculus Mouse nfac2_mouse Nuclear factor of activated T-cells, cytoplasmic 2 T-cell transcription factor NFAT1 NFAT pre-existing subunit Nfatc2 Nfat1 Nfatp protein protein mouse Mus musculus Mouse MDVPEPQPDPDGGDGPGHEPGGSPQDELDFSILFDYDYLNPIEEEPIAHKAISSPSGLAYPDDVLDYGLKPCNPLASLSGEPPGRFGEPDSIGFQNFLSPVKPAGASGPSPRIEITPSHELMQAGGALRGRDAGLSPEQPALALAGVAASPRFTLPVPGYEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNAGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVAPLPAASPQRSRSPSPQPSPHVALQDDSIPAGYPPTAGSAVLMDALNTLATDSPCGIPSKIWKTSPDPTPVSTAPSKAGLARHIYPTVEFLGPCEQEERRNSAPESILLVPPTWPKQLVPAIPICSIPVTASLPPLEWPLSNQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHVPEPSGRIVSLQAASNPIECSQRSAHELPMVERQDMDSCLVYGGQQMILTGQNFTAESKVVFMEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRVPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPSDEYEPSLICSPAHGGLGSQPYYPQHPMLAESPSCLVATMAPCQQFRSGLSSPDARYQQQSPAAALYQRSKSLSPGLLGYQQPSLLAAPLGLADAHRSVLVHAGSQGQGQGSTLPHTSSASQQASPVIHYSPTNQQLRGGGHQEFQHIMYCENFGPSSARPGPPPINQGQRLSPGAYPTVIQQQTAPSQRAAKNGPSDQKEALPTGVTVKQEQNLDQTYLDDVNEIIRKEFSGPPSRNQT arre2_element_mouse_il2_promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid in vitro In vitro CAAAGAGGAAAATTTGTTTCATACAGAAGG nfac2_human Nuclear factor of activated T-cells, cytoplasmic 2 T-cell transcription factor NFAT1 NFAT pre-existing subunit NFATC2 NFAT1 NFATP protein protein human Homo sapiens Human MNAPERQPQPDGGDAPGHEPGGSPQDELDFSILFDYEYLNPNEEEPNAHKVASPPSGPAYPDDVLDYGLKPYSPLASLSGEPPGRFGEPDRVGPQKFLSAAKPAGASGLSPRIEITPSHELIQAVGPLRMRDAGLLVEQPPLAGVAASPRFTLPVPGFEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNGGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVALPPGASPQRSRSPSPQPSSHVAPQDHGSPAGYPPVAGSAVIMDALNSLATDSPCGIPPKMWKTSPDPSPVSAAPSKAGLPRHIYPAVEFLGPCEQGERRNSAPESILLVPPTWPKPLVPAIPICSIPVTASLPPLEWPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPTDEYDPTLICSPTHGGLGSQPYYPQHPMVAESPSCLVATMAPCQQFRTGLSSPDARYQQQNPAAVLYQRSKSLSPSLLGYQQPALMAAPLSLADAHRSVLVHAGSQGQSSALLHPSPTNQQASPVIHYSPTNQQLRCGSHQEFQHIMYCENFAPGTTRPGPPPVSQGQRLSPGSYPTVIQQQNATSQRAAKNGPPVSDQKEVLPAGVTIKQEQNLDQTYLDDVNEIIRKEFSGPPARNQT foxp2_human Forkhead box protein P2 CAG repeat protein 44 Trinucleotide repeat-containing gene 10 protein FOXP2 CAGH44 TNRC10 protein protein human Homo sapiens Human MMQESATETISNSSMNQNGMSTLSSQLDAGSRDGRSSGDTSSEVSTVELLHLQQQQALQAARQLLLQQQTSGLKSPKSSDKQRPLQVPVSVAMMTPQVITPQQMQQILQQQVLSPQQLQALLQQQQAVMLQQQQLQEFYKKQQEQLHLQLLQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQHPGKQAKEQQQQQQQQQQLAAQQLVFQQQLLQMQQLQQQQHLLSLQRQGLISIPPGQAALPVQSLPQAGLSPAEIQQLWKEVTGVHSMEDNGIKHGGLDLTTNNSSSTTSSNTSKASPPITHHSIVNGQSSVLSARRDSSSHEETGASHTLYGHGVCKWPGCESICEDFGQFLKHLNNEHALDDRSTAQCRVQMQVVQQLEIQLSKERERLQAMMTHLHMRPSEPKPSPKPLNLVSSVTMSKNMLETSPQSLPQTPTTPTAPVTPITQGPSVITPASVPNVGAIRRRHSDKYNIPMSSEIAPNYEFYKNADVRPPFTYATLIRQAIMESSDRQLTLNEIYSWFTRTFAYFRRNAATWKNAVRHNLSLHKCFVRVENVKGAVWTVDEVEYQKRRSQKITGSPTLVKNIPTSLGYGAALNASLQAALAESSLPLLSNPGLINNASSGLLQAVHEDLNGSLDHIDSNGNSSPGCSPQPHIHSIHVKEEPVIAEDEDCPMSLVTTANHSPELEDDREIEEEPLSEDLE foxp1_human Forkhead box protein P1 FOXP1 Mac-1-regulated forkhead HSPC215 protein protein human Homo sapiens Human MMQESGTETKSNGSAIQNGSGGSNHLLECGGLREGRSNGETPAVDIGAADLAHAQQQQQQALQVARQLLLQQQQQQQVSGLKSPKRNDKQPALQVPVSVAMMTPQVITPQQMQQILQQQVLSPQQLQVLLQQQQALMLQQQQLQEFYKKQQEQLQLQLLQQQHAGKQPKEQQQVATQQLAFQQQLLQMQQLQQQHLLSLQRQGLLTIQPGQPALPLQPLAQGMIPTELQQLWKEVTSAHTAEETTGNNHSSLDLTTTCVSSSAPSKTSLIMNPHASTNGQLSVHTPKRESLSHEEHPHSHPLYGHGVCKWPGCEAVCEDFQSFLKHLNSEHALDDRSTAQCRVQMQVVQQLELQLAKDKERLQAMMTHLHVKSTEPKAAPQPLNLVSSVTLSKSASEASPQSLPHTPTTPTAPLTPVTQGPSVITTTSMHTVGPIRRRYSDKYNVPISSADIAQNQEFYKNAEVRPPFTYASLIRQAILESPEKQLTLNEIYNWFTRMFAYFRRNAATWKNAVRHNLSLHKCFVRVENVKGAVWTVDEVEFQKRRPQKISGNPSLIKNMQSSHAYCTPLNAALQASMAENSIPLYTTASMGNPTLGNLASAIREELNGAMEHTNSNESDSSPGRSPMQAVHPVHVKEEPLDPEEAEGPLSLVTTANHSPDFDHDRDYEDEPVNEDME foxp3-il2-1 503750 N/A 503754 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 503755 unspecified role unspecified role bait bait region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6A foxp3-il2-2 503750 N/A 503756 unspecified role unspecified role bait bait N/A 503754 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6A-2 foxp3-ctla4-1 503750 N/A 503757 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 503755 unspecified role unspecified role bait bait region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6A-3 foxp3-ctla4-2 503750 N/A 503756 unspecified role unspecified role bait bait N/A 503757 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6A-4 foxp3-il2ra_mouse_gene-1 503750 N/A 503758 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 503755 unspecified role unspecified role bait bait region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6A-5 foxp3-il2ra_mouse_gene-2 503750 N/A 503756 unspecified role unspecified role bait bait N/A 503758 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6A-6 nfatc2-il2-2 503750 N/A 503754 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 503759 unspecified role unspecified role bait bait association association false false false 6 B/C Q9BZS1 increased binding of Q60591 to ENSMUSG00000027720 CHEBI:4031 decreases binding of Q60591 to ENSMUSG00000027720 Cyclosporin A (CHEBI:4031) -an immunosuppressant, inhibiting the calcineurin induced dephosphorylation of NFATc, resulting in reduced IL2 production and suppression of T cell activation. nfatc2-ctla4-1 503750 N/A 503757 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 503759 unspecified role unspecified role bait bait association association false false false 6 B/C Q9BZS1 increased binding of Q60591 to ENSMUSG00000026011 Cyclosporin A (CHEBI:4031) -an immunosuppressant, inhibiting the calcineurin induced dephosphorylation of NFATc, resulting in reduced IL2 production and suppression of T cell activation. CHEBI:4031 decreases binding of Q60591 to ENSMUSG00000026011 nfatc2-il2ra_mouse_gene-1 503750 N/A 503758 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 503759 unspecified role unspecified role bait bait association association false false false 6 B/C Q9BZS1 increases binding of Q60591 to ENSMUSG00000026770 Cyclosporin A (CHEBI:4031) -an immunosuppressant, inhibiting the calcineurin induced dephosphorylation of NFATc, resulting in reduced IL2 production and suppression of T cell activation. CHEBI:4031 decreases binding of Q60591 to ENSMUSG00000026770 foxp3-nfatc2-1 503751 N/A 503755 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) N/A 503760 unspecified role unspecified role neutral component neutral component in vitro In vitro N/A 503761 unspecified role unspecified role neutral component neutral component dbd sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) association association false false false 1C Cooperative binding observed. foxp2-nfatc2-1 503751 N/A 503761 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 503760 unspecified role unspecified role neutral component neutral component in vitro In vitro N/A 503762 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) association association false false false S1E foxp1-nfatc2-1 503751 N/A 503761 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 503763 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind range range range range false ecoli Escherichia coli (strain K12) N/A 503760 unspecified role unspecified role neutral component neutral component in vitro In vitro association association false false false S1D foxp2-nfatc2 503752 N/A 503760 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro Stoichiometry: 1.0 N/A 503762 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false Stoichiometry: 1.0 N/A 503761 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false Stoichiometry: 1.0 direct interaction direct interaction false false false table S1 30.0-2.70 A 24.5% - 28.6% foxp2-nfatc2-2 503753 N/A 503760 unspecified role unspecified role neutral component neutral component in vitro In vitro N/A 503762 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 503761 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) physical association physical association false false false S1F