IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ chen-2005k-2 The nuclear receptors constitutive androstane receptor and pregnane X receptor cross-talk with hepatic nuclear factor 4alpha to synergistically activate the human CYP2C9 promoter. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen Y., Kissling G., Negishi M., Goldstein J.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The sequences of the probes used in the EMSA experiments are described in the materials and methods section and in the figures; however, there are slight differences between these sequences. The sequences given in the materials and methods section are used as participants in the interactions curated here (except those only mentioned in the figure). goldste1@niehs.nih.gov J. Pharmacol. Exp. Ther. (0022-3565) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease chen-2005k-1 The nuclear receptors constitutive androstane receptor and pregnane X receptor cross-talk with hepatic nuclear factor 4alpha to synergistically activate the human CYP2C9 promoter. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen Y., Kissling G., Negishi M., Goldstein J.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The sequences of the probes used in the EMSA experiments are described in the materials and methods section and in the figures; however, there are slight differences between these sequences. The sequences given in the materials and methods section are used as participants in the interactions curated here (except those only mentioned in the figure). goldste1@niehs.nih.gov J. Pharmacol. Exp. Ther. (0022-3565) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease cp2c9_human_hnf4a-site-152_dna-probe Human CP2C9 gene promoter HNF4A-152 binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CTAGCTGTATCAGTGGGTCAAAGTCCTTTC hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI apoc3_human_hnf4a-site_dna-probe-2 Human APOC3 gene promoter HNF4a binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CTAGGCGCTGGGCAAAGGTCACCTGC cp2c9_human_hnf4a-site-185_dna-probe Human CP2C9 gene promoter HNF4A-185 binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CTAGAACAAGACCAAAGGACATTTTAT cp2c9-hnf4a-4 1768331 n/a 1768333 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false Fig. 3b cp2c9-cp2c9-4 1768331 n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro n/a 1768333 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768333 competitor competitor competitor prey prey g15c_g16c_g17c mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false a20t_deletion-a-21_a-22 mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Two "T" residues have been deleted from this mutant. chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 3b cp2c9-apoc3-2 1768331 n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro n/a 1768333 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768335 competitor competitor competitor prey prey g12c_c13g_t19a_c20g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 3b cp2c9-hnf4a-5 1768331 n/a 1768336 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false Fig. 5b cp2c9-cp2c9-1 1768331 n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro n/a 1768336 competitor competitor competitor prey prey a14t_deletion-a-15_a-16 mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Two "T" residues have been deleted from this mutant. chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768336 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 5b cp2c9-apoc3-1 1768331 n/a 1768336 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768335 competitor competitor competitor prey prey g12c_c13g_t19a_c20g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro association association false false false Fig. 5b cp2c9-hnf4a-6 1768332 n/a 1768334 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1768333 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3b P41235 increases expression at RNA level of ENSG00000138109 P41235 and Q14994 increases expression at RNA level of ENSG00000138109 P41235 and O75469 increases expression at RNA level of ENSG00000138109 cp2c9-hnf4a-1 1768332 n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro n/a 1768333 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3b cp2c9-hnf4a-2 1768332 n/a 1768336 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768334 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association false false false Fig. 5b cp2c9-hnf4a-3 1768332 n/a 1768336 unspecified role unspecified role bait bait 5-prime dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1768334 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false Fig. 5b