IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ barbier-2005-3 Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis bart.staels@pasteur-lille.fr Mol. Pharmacol. (0026-895X) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease barbier-2005-1 Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis bart.staels@pasteur-lille.fr Mol. Pharmacol. (0026-895X) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease barbier-2005-2 Hepatic expression of the UGT1A9 gene is governed by hepatocyte nuclear factor 4alpha. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Barbier O., Girard H., Inoue Y., Duez H., Villeneuve L., Kamiya A., Fruchart J.C., Guillemette C., Gonzalez F.J., Staels B. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis bart.staels@pasteur-lille.fr Mol. Pharmacol. (0026-895X) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease ud19_human_hnf4a-re_dna-probe Human UD19 (UGT1A9) gene promoter HNF4a response element DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TTTGCTCTGGGACAAATTCCAAAAAAAATTAG hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI apoc3_human_hnf4a-re_dna-probe Human APOC3 gene promoter HNF4a response element DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAGCAGGTGACCTTTGCCCAGCGCCC ud19_human_gene UDP-glucuronosyltransferase 1-9 (UD19) human gene gene gene human Homo sapiens Human ud19-hnf4a-1 1599460 n/a 1599463 unspecified role unspecified role bait bait tttgctctgggacaaattccaa-to-tttgctctgggacgggccttga mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1599464 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false Fig. 4b In vitro translated HNF4alpha was shown to bind the UD19 DNA probe in an EMSA supershift assay using anti-HNF4alpha antibody. ud19-hnf4a-2 1599460 n/a 1599465 competitor competitor competitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1599463 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1599464 unspecified role unspecified role prey prey in vitro In vitro association association false false false Fig. 4c In vitro translated HNF4alpha was shown to bind the UD19 and APOC3 DNA probes in an EMSA supershift assay using anti-HNF4alpha antibody. ud19-hnf4a-3 1599460 n/a 1599463 competitor competitor competitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1599463 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1599464 unspecified role unspecified role prey prey in vitro In vitro association association false false false Fig. 4c In vitro translated HNF4alpha was shown to bind the UD19 DNA probe in an EMSA supershift assay using anti-HNF4alpha antibody. ud19-hnf4a-4 1599461 n/a 1599463 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1599464 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false Fig. 4a apoc3-hnf4a-2 1599461 n/a 1599464 unspecified role unspecified role prey prey in vitro In vitro n/a 1599465 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 4a hnf4a-ud19-1 1599462 n/a 1599464 unspecified role unspecified role bait bait n/a 1599466 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 5a P41235 increases expression at RNA level of ENSG00000241119