IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ shen-1997-2 Characterization and cell cycle regulation of the related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Shen M., Haggblom C., Vogt M., Hunter T., Lu KP. Cancer - Interactions investigated in the context of cancer klu@bidmc.harvard.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 1997 shen-1997-1 Characterization and cell cycle regulation of the related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Shen M., Haggblom C., Vogt M., Hunter T., Lu KP. Cancer - Interactions investigated in the context of cancer klu@bidmc.harvard.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 1997 shen-1997-3 Characterization and cell cycle regulation of the related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 confocal microscopy confocal microscopy immunostaining immunostaining Shen M., Haggblom C., Vogt M., Hunter T., Lu KP. Cancer - Interactions investigated in the context of cancer klu@bidmc.harvard.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 1997 p54274-2 Telomeric repeat-binding factor 1 TERF1 PIN2 TRBF1 TRF TRF1 NIMA-interacting protein 2 TTAGGG repeat-binding factor 1 Telomeric protein Pin2/TRF1 Pin2 protein protein human Homo sapiens Human MAEDVSSAAPSPRGCADGRDADPTEEQMAETERNDEEQFECQELLECQVQVGAPEEEEEEEEDAGLVAEAEAVAAGWMLDFLCLSLCRAFRDGRSEDFRRTRNSAEAIIHGLSSLTACQLRTIYICQFLTRIAAGKTLDAQFENDERITPLESALMIWGSIEKEHDKLHEEIQNLIKIQAIAVCMENGNFKEAEEVFERIFGDPNSHMPFKSKLLMIISQKDTFHSFFQHFSYNHMMEKIKSYVNYVLSEKSSTFLMKAAAKVVESKRTRTITSQDKPSGNDVEMETEANLDTRKRSHKNLFLSKLQHGTQQQDLNKKERRVGTPQSTKKKKESRRATESRIPVSKSQPVTPEKHRARKRQAWLWEEDKNLRSGVRKYGEGNWSKILLHYKFNNRTSVMLKDRWRTMKKLKLISSDSED p54274-1 Telomeric repeat-binding factor 1 TERF1 PIN2 TRBF1 TRF TRF1 NIMA-interacting protein 2 TTAGGG repeat-binding factor 1 Telomeric protein Pin2/TRF1 TRF1 protein protein human Homo sapiens Human MAEDVSSAAPSPRGCADGRDADPTEEQMAETERNDEEQFECQELLECQVQVGAPEEEEEEEEDAGLVAEAEAVAAGWMLDFLCLSLCRAFRDGRSEDFRRTRNSAEAIIHGLSSLTACQLRTIYICQFLTRIAAGKTLDAQFENDERITPLESALMIWGSIEKEHDKLHEEIQNLIKIQAIAVCMENGNFKEAEEVFERIFGDPNSHMPFKSKLLMIISQKDTFHSFFQHFSYNHMMEKIKSYVNYVLSEKSSTFLMKAAAKVVESKRTRTITSQDKPSGNDVEMETEANLDTRKSVSDKQSAVTESSEGTVSLLRSHKNLFLSKLQHGTQQQDLNKKERRVGTPQSTKKKKESRRATESRIPVSKSQPVTPEKHRARKRQAWLWEEDKNLRSGVRKYGEGNWSKILLHYKFNNRTSVMLKDRWRTMKKLKLISSDSED telodna Human telomeric repeat DNA dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG pin2-pin2-1 Homodimerisation of human Pin2 detected by coIP 509413 N/A 509416 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false N/A 509416 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 3B pin2-trf1-1 Interaction between human Pin2 and TRF1 detected by coIP 509413 N/A 509417 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 509416 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 3B pin2-telodna-1 Interaction between human Pin2 and telomeric DNA detected by EMSA 509414 N/A 509416 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) N/A 509418 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false direct interaction direct interaction false false false 3A Binding is significantly enhanced by 1mg per ml casein. pin2-trf1-2 Interaction between human Pin2 and TRF1 detected by confocal 509415 N/A 509416 unspecified role unspecified role neutral component neutral component N/A 509417 unspecified role unspecified role neutral component neutral component colocalization colocalization false false false 4A