IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ chen-2009-11 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-4 yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer Screen performed in the presence of Estradiol CHEBI:23965. shuyuan_yeh@urmc.rochester.edu Human testis cDNA Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-5 yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer Source of NCOA1/SRC-1 traced back to PMID:7481822 shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-13 in vitro In vitro pull down pull down weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer Assay performed in the presence of Estradiol CHEBI:23965. shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-6 human-lncap Human caucasian prostate carcinoma lncap Human caucasian prostate adenocarcinoma fluorescence imaging fluorescence microscopy fluorescence imaging immunostaining immunostaining Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-7 human-lncap Human caucasian prostate carcinoma lncap Human caucasian prostate adenocarcinoma anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-8 in vitro In vitro anti tag coip anti tag coimmunoprecipitation anti tag coip weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-9 chlae-cos_1 Chlorocebus aethiops COS-1 cells Grivet cos_1 CV-1 Simian cells (cercopithecus aethiops) transformed by SV40 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-10 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation chen-2009-12 human-lncap Human caucasian prostate carcinoma lncap Human caucasian prostate adenocarcinoma ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation esr2_human Estrogen receptor beta ESR2 ESTRB NR3A2 Nuclear receptor subfamily 3 group A member 2 protein protein human Homo sapiens Human MDIKNSPSSLNSPSSYNCSQSILPLEHGSIYIPSSYVDSHHEYPAMTFYSPAVMNYSIPSNVTNLEGGPGRQTTSPNVLWPTPGHLSPLVVHRQLSHLYAEPQKSPWCEARSLEHTLPVNRETLKRKVSGNRCASPVTGPGSKRDAHFCAVCSDYASGYHYGVWSCEGCKAFFKRSIQGHNDYICPATNQCTIDKNRRKSCQACRLRKCYEVGMVKCGSRRERCGYRLVRRQRSADEQLHCAGKAKRSGGHAPRVRELLLDALSPEQLVLTLLEAEPPHVLISRPSAPFTEASMMMSLTKLADKELVHMISWAKKIPGFVELSLFDQVRLLESCWMEVLMMGLMWRSIDHPGKLIFAPDLVLDRDEGKCVEGILEIFDMLLATTSRFRELKLQHKEYLCVKAMILLNSSMYPLVTATQDADSSRKLAHLLNAVTDALVWVIAKSGISSQQQSMRLANLLMLLSHVRHASNKGMEHLLNMKCKNVVPVYDLLLEMLNAHVLRGCKSSITGSECSPAEDSKSKEGSQNPQSQ estrogen response element Estrogen response element ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GATCTCTTTGATCAGGTCACTGTGACCTGACTTTG ccd62_human Coiled-coil domain-containing protein 62 Protein TSP-NY Protein aaa CCDC62 protein protein human Homo sapiens Human MNPPAAFLAGRQNIGSEVEISTIEKQRKELQLLIGELKDRDKELNDMVAVHQQQLLSWEEDRQKVLTLEERCSKLEGELHKRTEIIRSLTKKVKALESNQMECQTALQKTQLQLQEMAQKATHSSLLSEDLEARNETLSNTLVELSAQVGQLQAREQALTTMIKLKDKDIIEAVNHIADCSGKFKMLEHALRDAKMAETCIVKEKQDYKQKLKALKIEVNKLKEDLNEKTTENNEQREEIIRLKQEKSCLHDELLFTVEREKRKDELLNIAKSKQERTNSELHNLRQIYVKQQSDLQFLNFNVENSQELIQMYDSKMEESKALDSSRDMCLSDLENNHPKVDIKREKNQKSLFKDQKFEAMLVQQNRSDKSSCDECKEKKQQIDTVFGEKSVITLSSIFTKDLVEKHNLPWSLGGKTQIEPENKITLCKIHTKSPKCHGTGVQNEGKQPSETPTLSDEKQWHDVSVYLGLTNCPSSKHPEKLDVECQDQMERSEISCCQKNEACLGESGMCDSKCCHPSNFIIEAPGHMSDVEWMSIFKPSKMQRIVRLKSGCTCSESICGTQHDSPASELIAIQDSHSLGSSKSALREDETESSSNKKNSPTSLLIYKDAPAFNEKASIVLPSQDDFSPTSKLQRLLAESRQMVTDLELSTLLPISHENLTGSATNKSEVPEESAQKNTFVSY q92731-1 Estrogen receptor beta Nuclear receptor subfamily 3 group A member 2 Beta-1 ESR2 ESTRB NR3A2 protein protein human Homo sapiens Human MDIKNSPSSLNSPSSYNCSQSILPLEHGSIYIPSSYVDSHHEYPAMTFYSPAVMNYSIPSNVTNLEGGPGRQTTSPNVLWPTPGHLSPLVVHRQLSHLYAEPQKSPWCEARSLEHTLPVNRETLKRKVSGNRCASPVTGPGSKRDAHFCAVCSDYASGYHYGVWSCEGCKAFFKRSIQGHNDYICPATNQCTIDKNRRKSCQACRLRKCYEVGMVKCGSRRERCGYRLVRRQRSADEQLHCAGKAKRSGGHAPRVRELLLDALSPEQLVLTLLEAEPPHVLISRPSAPFTEASMMMSLTKLADKELVHMISWAKKIPGFVELSLFDQVRLLESCWMEVLMMGLMWRSIDHPGKLIFAPDLVLDRDEGKCVEGILEIFDMLLATTSRFRELKLQHKEYLCVKAMILLNSSMYPLVTATQDADSSRKLAHLLNAVTDALVWVIAKSGISSQQQSMRLANLLMLLSHVRHASNKGMEHLLNMKCKNVVPVYDLLLEMLNAHVLRGCKSSITGSECSPAEDSKSKEGSQNPQSQ ncoa1_human Nuclear receptor coactivator 1 Steroid receptor coactivator 1 RIP160 Protein Hin-2 Renal carcinoma antigen NY-REN-52 NCOA1 SRC1 BHLHE74 Class E basic helix-loop-helix protein 74 protein protein human Homo sapiens Human MSGLGDSSSDPANPDSHKRKGSPCDTLASSTEKRRREQENKYLEELAELLSANISDIDSLSVKPDKCKILKKTVDQIQLMKRMEQEKSTTDDDVQKSDISSSSQGVIEKESLGPLLLEALDGFFFVVNCEGRIVFVSENVTSYLGYNQEELMNTSVYSILHVGDHAEFVKNLLPKSLVNGVPWPQEATRRNSHTFNCRMLIHPPDEPGTENQEACQRYEVMQCFTVSQPKSIQEDGEDFQSCLICIARRLPRPPAITGVESFMTKQDTTGKIISIDTSSLRAAGRTGWEDLVRKCIYAFFQPQGREPSYARQLFQEVMTRGTASSPSYRFILNDGTMLSAHTKCKLCYPQSPDMQPFIMGIHIIDREHSGLSPQDDTNSGMSIPRVNPSVNPSISPAHGVARSSTLPPSNSNMVSTRINRQQSSDLHSSSHSNSSNSQGSFGCSPGSQIVANVALNQGQASSQSSNPSLNLNNSPMEGTGISLAQFMSPRRQVTSGLATRPRMPNNSFPPNISTLSSPVGMTSSACNNNNRSYSNIPVTSLQGMNEGPNNSVGFSASSPVLRQMSSQNSPSRLNIQPAKAESKDNKEIASILNEMIQSDNSSSDGKPLDSGLLHNNDRLSDGDSKYSQTSHKLVQLLTTTAEQQLRHADIDTSCKDVLSCTGTSNSASANSSGGSCPSSHSSLTERHKILHRLLQEGSPSDITTLSVEPDKKDSASTSVSVTGQVQGNSSIKLELDASKKKESKDHQLLRYLLDKDEKDLRSTPNLSLDDVKVKVEKKEQMDPCNTNPTPMTKPTPEEIKLEAQSQFTADLDQFDQLLPTLEKAAQLPGLCETDRMDGAVTSVTIKSEILPASLQSATARPTSRLNRLPELELEAIDNQFGQPGTGDQIPWTNNTVTAINQSKSEDQCISSQLDELLCPPTTVEGRNDEKALLEQLVSFLSGKDETELAELDRALGIDKLVQGGGLDVLSERFPPQQATPPLIMEERPNLYSQPYSSPSPTANLPSPFQGMVRQKPSLGTMPVQVTPPRGAFSPGMGMQPRQTLNRPPAAPNQLRLQLQQRLQGQQQLIHQNRQAILNQFAATAPVGINMRSGMQQQITPQPPLNAQMLAQRQRELYSQQHRQRQLIQQQRAMLMRQQSFGNNLPPSSGLPVQMGNPRLPQGAPQQFPYPPNYGTNPGTPPASTSPFSQLAANPEASLANRNSMVSRGMTGNIGGQFGTGINPQMQQNVFQYPGAGMVPQGEANFAPSLSPGSSMVPMPIPPPQSSLLQQTPPASGYQSPDMKAWQQGAIGNNNVFSQAVQNQPTPAQPGVYNNMSITVSMAGGNTNVQNMNPMMAQMQMSSLQMPGMNTVCPEQINDPALRHTGLYCNQLSSTDLLKTEADGTQQVQQVQVFADVQCTVNLVGGDPYLNQPGPLGTQKPTSGPQTPQAQQKSLLQQLLTE ccnd1_human_gene Human Cyclin D1 gene gene gene human Homo sapiens Human esr2-estrogen response element-1 1861173 N/A 1861183 unspecified role unspecified role prey prey purified purified in vitro In vitro N/A 1861184 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Fig. 3D CHEBI:16469 esr2-estrogen response element-2 1861173 N/A 1861184 competitor competitor competitor prey prey region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false G_T16-17T_A mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false N/A 1861183 unspecified role unspecified role prey prey purified purified chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1861184 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro physical association physical association false false false Fig. 3D CHEBI:16469 esr2-ccdc62-6 1861173 N/A 1861185 unspecified role unspecified role prey prey in vitro In vitro N/A 1861183 unspecified role unspecified role prey prey purified purified in vitro In vitro N/A 1861184 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3D CHEBI:16469 esr2-ccdc62-1 1861174 N/A 1861186 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false N/A 1861185 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 1861209 1861207 physical association physical association false false false esr2-ncoa1-1 1861174 N/A 1861187 unspecified role unspecified role prey prey N/A 1861186 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false esr2-ccdc62-2 1861175 N/A 1861186 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false N/A 1861185 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 1861218 1861216 physical association physical association false false false Fig. 1A, 1B Estradiol CHEBI:23965 esr2-ncoa1-2 1861175 N/A 1861187 unspecified role unspecified role prey prey N/A 1861186 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Fig. 1A., 1B Estradiol CHEBI:23965 esr2-ccdc62-7 1861176 N/A 1861186 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 1861185 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Fig. 4A CHEBI:16469 ccdc62-esr2-2 1861176 N/A 1861186 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 1861185 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false LXXLL motif required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Fig. 4B, 4C CHEBI:16469 esr2-ccdc62-3 1861177 N/A 1861183 unspecified role unspecified role neutral component neutral component N/A 1861185 unspecified role unspecified role neutral component neutral component colocalization colocalization false false false Estradiol CHEBI:23965 Fig. 2D ccdc62-esr2-1 1861178 N/A 1861183 unspecified role unspecified role bait bait N/A 1861185 unspecified role unspecified role prey prey physical association physical association false false false Estradiol CHEBI:23965 Fig. 3C esr2-ccdc62-4 1861179 N/A 1861186 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro N/A 1861185 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Fig. 3B CHEBI:16469 CHEBI:16469 activates q92731-1 (GO:0005515) esr2-ccdc62-5 1861180 N/A 1861186 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region gal4 dna bd gal4 dna binding domain gal4 dna bd undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1861185 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region vp16 ad vp16 activation domain vp16 ad undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false 1861255 1861252 physical association physical association false false false Fig. 3A, 4D Estradiol CHEBI:23965 Fulvestrant (ICI-182780 CHEBI:31638) estrogen response element-esr2-1 1861181 N/A 1861183 unspecified role unspecified role prey prey purified purified in vitro In vitro N/A 1861184 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Fig. 3D ccdc62-ccnd1_human_gene-1 1861182 N/A 1861185 unspecified role unspecified role bait bait N/A 1861188 unspecified role unspecified role prey prey AP-1 site_promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 3E Estradiol CHEBI:23965 CHEBI:23965 increases expression at RNA level of ENSG00000110092 Q6P9F0 increases expression at RNA level of ENSG00000110092 P10275 causes no change at RNA level to ENSG00000110092