IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ lee-2007c-2 EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw Mol. Biol. Cell (1059-1524) 2007 lee-2007c-3 EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. anti bait coip anti bait coimmunoprecipitation anti bait coip primer specific pcr primer specific pcr Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer AGS cells were treated or not treated with 10 nM EGF for 1 and 4 hours. Immunoprecipitation was carried out. RNA from immunoprecipitated complexes was extracted and subjected to RT-PCR analysis. tctseng@mail.ncku.edu.tw Mol. Biol. Cell (1059-1524) 2007 lee-2007c-1 EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. in vitro In vitro pull down pull down ms participant Identification by mass spectrometry ms participant Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw Mol. Biol. Cell (1059-1524) 2007 lee-2007c-4 EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw Mol. Biol. Cell (1059-1524) 2007 pcbp1_human Poly(rC)-binding protein 1 PCBP1 Alpha-CP1 Nucleic acid-binding protein SUB2.3 Heterogeneous nuclear ribonucleoprotein E1 protein protein human Homo sapiens Human MDAGVTESGLNVTLTIRLLMHGKEVGSIIGKKGESVKRIREESGARINISEGNCPERIITLTGPTNAIFKAFAMIIDKLEEDINSSMTNSTAASRPPVTLRLVVPATQCGSLIGKGGCKIKEIRESTGAQVQVAGDMLPNSTERAITIAGVPQSVTECVKQICLVMLETLSQSPQGRVMTIPYQPMPASSPVICAGGQDRCSDAAGYPHATHDLEGPPLDAYSIQGQHTISPLDLAKLNQVARQQSHFAMMHGGTGFAGIDSSSPEVKGYWASLDASTQTTHELTIPNNLIGCIIGRQGANINEIRQMSGAQIKIANPVEGSSGRQVTITGSAASISLAQYLINARLSSEKGMGCS anr28_human Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit A ANKRD28 KIAA0379 Ankyrin repeat domain-containing protein 28 Phosphatase interactor targeting protein hnRNP K protein protein human Homo sapiens Human MAFLKLRDQPSLVQAIFNGDPDEVRALIFKKEDVNFQDNEKRTPLHAAAYLGDAEIIELLILSGARVNAKDSKWLTPLHRAVASCSEEAVQVLLKHSADVNARDKNWQTPLHIAAANKAVKCAEALVPLLSNVNVSDRAGRTALHHAAFSGHGEMVKLLLSRGANINAFDKKDRRAIHWAAYMGHIEVVKLLVSHGAEVTCKDKKSYTPLHAAASSGMISVVKYLLDLGVDMNEPNAYGNTPLHVACYNGQDVVVNELIDCGAIVNQKNEKGFTPLHFAAASTHGALCLELLVGNGADVNMKSKDGKTPLHMTALHGRFSRSQTIIQSGAVIDCEDKNGNTPLHIAARYGHELLINTLITSGADTAKRGIHGMFPLHLAALSGFSDCCRKLLSSGFDIDTPDDFGRTCLHAAAAGGNLECLNLLLNTGADFNKKDKFGRSPLHYAAANCNYQCLFALVGSGASVNDLDERGCTPLHYAATSDTDGKCLEYLLRNDANPGIRDKQGYNAVHYSAAYGHRLCLQLIASETPLDVLMETSGTDMLSDSDNRATISPLHLAAYHGHHQALEVLVQSLLDLDVRNSSGRTPLDLAAFKGHVECVDVLINQGASILVKDYILKRTPIHAAATNGHSECLRLLIGNAEPQNAVDIQDGNGQTPLMLSVLNGHTDCVYSLLNKGANVDAKDKWGRTALHRGAVTGHEECVDALLQHGAKCLLRDSRGRTPIHLSAACGHIGVLGALLQSAASMDANPATADNHGYTALHWACYNGHETCVELLLEQEVFQKTEGNAFSPLHCAVINDNEGAAEMLIDTLGASIVNATDSKGRTPLHAAAFTDHVECLQLLLSHNAQVNSVDSTGKTPLMMAAENGQTNTVEMLVSSASAELTLQDNSKNTALHLACSKGHETSALLILEKITDRNLINATNAALQTPLHVAARNGLTMVVQELLGKGASVLAVDENGYTPALACAPNKDVADCLALILATMMPVSSSSPLSSLTFNAINRYTNTSKTVSFEALPIMRNEPSSYCSFNNIGGEQEYLYTDVDELNDSDSETY probe_c_rna Probe C based on structure of human gastrin mRNA (384-409) rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) CCCAGCCCUGUCCCCUGAAAAACUGA probe_b_rna Probe B based on structure of human gastrin mRNA (366-387) rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AGCCACCUCCCACCCCACCCCA nucl_human Nucleolin NCL Protein C23 protein protein human Homo sapiens Human MVKLAKAGKNQGDPKKMAPPPKEVEEDSEDEEMSEDEEDDSSGEEVVIPQKKGKKAAATSAKKVVVSPTKKVAVATPAKKAAVTPGKKAAATPAKKTVTPAKAVTTPGKKGATPGKALVATPGKKGAAIPAKGAKNGKNAKKEDSDEEEDDDSEEDEEDDEDEDEDEDEIEPAAMKAAAAAPASEDEDDEDDEDDEDDDDDEEDDSEEEAMETTPAKGKKAAKVVPVKAKNVAEDEDEEEDDEDEDDDDDEDDEDDDDEDDEEEEEEEEEEPVKEAPGKRKKEMAKQKAAPEAKKQKVEGTEPTTAFNLFVGNLNFNKSAPELKTGISDVFAKNDLAVVDVRIGMTRKFGYVDFESAEDLEKALELTGLKVFGNEIKLEKPKGKDSKKERDARTLLAKNLPYKVTQDELKEVFEDAAEIRLVSKDGKSKGIAYIEFKTEADAEKTFEEKQGTEIDGRSISLYYTGEKGQNQDYRGGKNSTWSGESKTLVLSNLSYSATEETLQEVFEKATFIKVPQNQNGKSKGYAFIEFASFEDAKEALNSCNKREIEGRAIRLELQGPRGSPNARSQPSKTLFVKGLSEDTTEETLKESFDGSVRARIVTDRETGSSKGFGFVDFNSEEDAKAAKEAMEDGEIDGNKVTLDWAKPKGEGGFGGRGGGRGGFGGRGGGRGGRGGFGGRGRGGFGGRGGFRGGRGGGGDHKPQGKKTKFE probe_d_n_rna Probe D-N based on structure of human gastrin mRNA (384-409) with mutation of C-rich region rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AAAAGCCCUGUCAAAUGAAAAACUGA probe_e_rna Probe E based on structure of human gastrin mRNA (342-369) rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) CCCAGAAAUGUCCCCUGAAAAACUGA gastrin_human_mrna Human gastrin mRNA (full cds) mrna messenger rna mRNA mrna human Homo sapiens Human AGTCTCTGCTCTTCCCAGCCTCTCCGGCGCGCTCCAAGGGCTTCCCGTCGGGACCATGCGCGGCAGTGAGCTCCCGCTGGTCCTGCTGGCGCTGGTCCTCTGCCTAGCGCCCCGGGGGCGAGCGGTCCCGCTGCCTGCGGGCGGAGGGACCGTGCTGACCAAGATGTACCCGCGCGGCAACCACTGGGCGGTGGGGCACTTAATGGGGAAAAAGAGCACAGGGGAGTCTTCTTCTGTTTCTGAGAGAGGGAGCCTGAAGCAGCAGCTGAGAGAGTACATCAGGTGGGAAGAAGCTGCAAGGAATTTGCTGGGTCTCATAGAAGCAAAGGAGAACAGAAACCACCAGCCACCTCAACCCAAGGCCTTGGGCAATCAGCAGCCTTCGTGGGATTCAGAGGATAGCAGCAACTTCAAAGATGTAGGTTCAAAAGGCAAAGTTGGTAGACTCTCTGCTCCAGGTTCTCAACGTGAAGGAAGGAACCCCCAGCTGAACCAGCAATGATAATGATGGCCTCTCTCAAAAGAGAAAAACAAAACCCCTAAGAGACTGAGTTCTGCAAGCATCAGTTCTACGGATCATCAACAAGATTTCCTTGTGCAAAATATTTGACTATTCTGTATCTTTCATCCTTGACTAAATTCGTGATTTTCAAGCAGCATCTTCTGGTTTAAACTTGTTTGCTGTGAACAATTGTCGAAAAGAGTCTTCCAATTAATGCTTTTTTATATCTAGGCTACCTGTTGGTTAGATTCAAGGCCCCGAGCTGTTACCATTCACAATAAAAGCTTAAACACAT probe_c-ankrd28-1 Probe C based on human gastrin mRNA (384-409) pulls down PCBP1 and hnRNP K 676712 N/A 676716 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676717 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676718 unspecified role unspecified role bait bait association association false false false 3 C The RNA probe based on human gastrin mRNA (384-409) was labeled with biotin. probe_b-ankrd28-1 Probe B based on human gastrin mRNA (366-387) pulls down PCBP1 and hnRNP K 676712 N/A 676716 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676717 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676719 unspecified role unspecified role bait bait association association false false false 3 C The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. probe_b-ncl Probe B based on human gastrin mRNA (366-387) pulls down nucleolin 676712 N/A 676719 unspecified role unspecified role bait bait n/a 676720 unspecified role unspecified role prey prey physical association physical association false false false The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 4 A probe_c-ncl-1 Probe C based on human gastrin mRNA (366-387) pulls down nucleolin 676712 N/A 676718 unspecified role unspecified role bait bait n/a 676720 unspecified role unspecified role prey prey physical association physical association false false false The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 4 A probe_b-ankrd28-2 Probe B based on human gastrin mRNA (366-387) pulls down nucleolin and hnRNP K 676712 N/A 676717 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676719 unspecified role unspecified role bait bait n/a 676720 unspecified role unspecified role prey prey association association false false false 5 B The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. Probe B bound with lower level nucleolin protein than probe C. Mutation of the C-rich region of probe B abolished the binding activity of nucleolin (Probe F). probe_c-ankrd28-2 Probe C based on human gastrin mRNA (366-387) pulls down nucleolin and hnRNP K 676712 N/A 676718 unspecified role unspecified role bait bait N/A 676717 unspecified role unspecified role prey prey n/a 676720 unspecified role unspecified role prey prey association association false false false The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 5 B Mutation of the putative nucleolin binding site AGCCCU to AGAAAU abolished binding of nucleolin (Probe E). probe_d_n-ankrd28-3 Probe D-N based on human gastrin mRNA (366-387) lacking C-rich region pulls down nucleolin and hnRNP K 676712 n/a 676720 unspecified role unspecified role prey prey N/A 676721 unspecified role unspecified role bait bait N/A 676717 unspecified role unspecified role prey prey association association false false false The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 5 B Binding of nucleolin and hnRNP K to probe D-N was decreased as compared to binding to probe B and Probe C. probe_e-ankrd28 Probe E based on human gastrin mRNA (366-387) with mutation of nucleolin binding site pulls down nucleolin 676712 N/A 676717 unspecified role unspecified role prey prey N/A 676722 unspecified role unspecified role bait bait physical association physical association false false false 5 B Nucleolin could not bind with probe E as the putative nucleolin binding site AGCCCU was mutated to AGAAAU. ankrd29-gastrin_hu hnRNP K coimmunoprecipitates human gastrin mRNA in AGS lysates 676713 N/A 676717 unspecified role unspecified role bait bait N/A 676723 unspecified role unspecified role prey prey physical association physical association false false false 3 D The amount of associated gastrin mRNA was unchanged under EGF treatment. pcbp1-gastrin_hu-1 PCBP1 coimmunoprecipitates human gastrin mRNA in AGS lysates 676713 N/A 676716 unspecified role unspecified role bait bait N/A 676723 unspecified role unspecified role prey prey physical association physical association false false false 3 D The amount of associated gastrin mRNA was unchanged under EGF treatment. ncl-gastrin_hu-1 Nucleolin coimmunoprecipitates human gastrin mRNA in AGS lysates 676713 n/a 676720 unspecified role unspecified role bait bait N/A 676723 unspecified role unspecified role prey prey physical association physical association false false false 4 B EGF - The amount of associated gastrin mRNA was slightly increased under EGF treatment for 4 hours. probe_b-ankrd28 Probe B based on human gastrin mRNA (366-387) pulls down PCBP1 and hnRNP K 676714 N/A 676716 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676719 unspecified role unspecified role bait bait N/A 676717 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. association association false false false 3 A, B The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. probe_c-ankrd28 Probe C based on human gastrin mRNA (384-409) pulls down PCBP1 and hnRNP K 676714 N/A 676716 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. N/A 676718 unspecified role unspecified role bait bait N/A 676717 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. association association false false false 3 A, B The RNA probe based on human gastrin mRNA (384-409) was labeled with biotin. ankrd28-ncl PCBP1 coimmunoprecipitates nucleolin in AGS lysates 676715 n/a 676720 unspecified role unspecified role prey prey N/A 676717 unspecified role unspecified role bait bait physical association physical association false false false 4 D, E RNase treatment did not disrupt this interaction, indicating that the interaction is not mediated by gastrin mRNA but is a protein-protein interaction not a protein-RNA-protein interaction. EGF - This interaction increased under EGF treatment.