IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ berg-2002-1 Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. in vitro In vitro fret fluorescent resonance energy transfer FRET RET FRET analysis FRET RET FRET analysis fret predetermined predetermined participant predetermined Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 berg-2002-2 Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. in vitro In vitro elisa enzyme linked immunosorbent assay ELISA ELISA elisa antibody detection identification by antibody antibody detection Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 berg-2002-3 Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 berg-2002-4 Small-molecule antagonists of Myc/Max dimerization inhibit Myc-induced transformation of chicken embryo fibroblasts. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Berg T., Cohen SB., Desharnais J., Sonderegger C., Maslyar DJ., Goldberg J., Boger DL., Vogt PK. Cancer - Interactions investigated in the context of cancer pkvogt@scripps.edu Proc. Natl. Acad. Sci. U.S.A. (0027-8424) 2002 max_rat Protein max Max Myc-associated factor X protein protein rat Rattus norvegicus (Rat) Rat MSDNDDIEVESDEEQPRFQSAADKRAHHNALERKRRDHIKDSFHSLRDSVPSLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALEKARSSAQLQTNYPSSDNSLYTNAKGGTISAFDGGSDSSSESEPEEPQNRKKLRMEAS myc_human Myc proto-oncogene protein BHLHE39 Transcription factor p64 MYC Proto-oncogene c-Myc Class E basic helix-loop-helix protein 39 protein protein human Homo sapiens Human MPLNVSFTNRNYDLDYDSVQPYFYCDEEENFYQQQQQSELQPPAPSEDIWKKFELLPTPPLSPSRRSGLCSPSYVAVTPFSLRGDNDGGGGSFSTADQLEMVTELLGGDMVNQSFICDPDDETFIKNIIIQDCMWSGFSAAAKLVSEKLASYQAARKDSGSPNPARGHSVCSTSSLYLQDLSAAASECIDPSVVFPYPLNDSSSPKSCASQDSSAFSPSSDSLLSSTESSPQGSPEPLVLHEETPPTTSSDSEEEQEDEEEIDVVSVEKRQAPGKRSESGSPSAGGHSKPPHSPLVLKRCHVSTHQHNYAAPPSTRKDYPAAKRVKLDSVRVLRQISNNRKCTSPRSSDTEENVKRRTHNVLERQRRNELKRSFFALRDQIPELENNEKAPKVVILKKATAYILSVQAEEQKLISEEDLLRKRREQLKHKLEQLRNSCA myc_max_consensus-1 Consensus binding site of c-Myc/Max dimers AGTTGACCACGTGGTCTGGG dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) AGTTGACCACGTGGTCTGGG myc-max-1 FRET demonstrates the dimerization of Myc with Max 576050 N/A 576054 unspecified role unspecified role fluorescence accept fluorescence acceptor fluorescence accept c-terminal yfp tag yellow fluorescent protein tag YFP yellow fluorescent protein yellow fluorescent protein YFP yfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) N/A 576055 unspecified role unspecified role fluorescence donor fluorescence donor c-terminal cfp tag cyan fluorescent protein tag CFP cyan fluorescent protein cyan fluorescent protein CFP cfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) direct interaction direct interaction false false false Table 1 This interaction was inhibited by four compounds from a peptidomimetic library (IIA4B20, IIA6B17, IIA4B11 and IA4B11). max-myc-1 ELISA demonstrates the dimerization of Myc with Max 576051 N/A 576054 unspecified role unspecified role bait bait region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) N/A 576055 unspecified role unspecified role prey prey c-terminal gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) 576069 576066 direct interaction direct interaction false false false Table 1 This interaction was inhibited by three compounds from a peptidomimetic library (IIA4B20, IIA6B17 and IIA4B11). max-myc-2 EMSA shows that the MycGFP/Max dimer binds the Myc/Max binding consensus sequence 576052 N/A 576055 unspecified role unspecified role neutral component neutral component region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false c-terminal gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecobb Escherichia coli (strain B / BL21) N/A 576056 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 576054 unspecified role unspecified role neutral component neutral component region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) association association false false false 2 This interaction was inhibited by three compounds from a peptidomimetic library (IIA6B17,IIA4B11 and IA4B1). max-myc-3 An EMSA supershift assay shows that the MycGFP/Max dimer binds the Myc/Max binding consensus sequence 576053 N/A 576054 unspecified role unspecified role neutral component neutral component region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) N/A 576056 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 576055 unspecified role unspecified role neutral component neutral component c-terminal gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false region bHLHZip domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecobb Escherichia coli (strain B / BL21) association association false false false 2 A This interaction was inhibited by three compounds from a peptidomimetic library (IIA6B17,IIA4B11 and IA4B1).