IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ deutsch-2011-3 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. in vitro In vitro crosslink cross-linking study crosslink weight by comassie molecular weight estimation by coomasie staining weight by comassie Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-7 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. in vitro In vitro fps fluorescence polarization spectroscopy Fluorescence anisotropy FPS FPS Fluorescence anisotropy fps predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-1 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. ecoli Escherichia coli (strain K12) molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-2 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. ecoli Escherichia coli (strain K12) light scattering light scattering predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-5 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. ecoli Escherichia coli (strain K12) solution sedimentati cosedimentation in solution solution sedimentati predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-9 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-6 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. mouse-oocyte Mus musculus oocyte Oocyte molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column western blot western blot Immuno blot Immuno blot Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Gamma-irradiation (Gy) Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-8 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-4 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. ecoli Escherichia coli (strain K12) ms of complexes mass spectrometry studies of complexes ms of complexes ms participant Identification by mass spectrometry ms participant Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation deutsch-2011-10 DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. in vitro In vitro nmr nuclear magnetic resonance NMR NMR nmr predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. vdoetsch@em.uni-frankfurt.de Cell (0092-8674) 2011 Only protein-protein interactions imex curation o88898-1 Tumor protein 63 TA*-alpha TA*p63alpha Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like protein protein mouse Mus musculus Mouse MNFETSRCATLQYCPDPYIQRFIETPAHFSWKESYYRSAMSQSTQTSEFLSPEVFQHIWDFLEQPICSVQPIELNFVDEPSENGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSMQSQSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTMPEGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHDFSSPPHLLRTPSGASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDSRRNKQQRIKEEGE Produced by alternative promoter usage. o88898-5 Tumor protein 63 Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like TA*-gamma TA*p63gamma protein protein mouse Mus musculus Mouse MNFETSRCATLQYCPDPYIQRFIETPAHFSWKESYYRSAMSQSTQTSEFLSPEVFQHIWDFLEQPICSVQPIELNFVDEPSENGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDAFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKHLLSACFRNELVEPRGEAPTQSDVFFRHSNPPNHSVYP Produced by alternative splicing of isoform 1. p21_promoter_human_dna DNA region from Human p21 promotor region ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) GGCAGGAACATGTCCCAACATGTTGAGCCG cctattctagacatgtgaggacatgtcgatacttattcc SELEX-genreated oligonucleotide ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) CCTATTCTAGACATGTGAGGACATGTCGATACTTATTCC o88898-2 Tumor protein 63 Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like DeltaN-alpha protein protein mouse Mus musculus Mouse MLYLENNAQTQFSEPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSMQSQSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTMPEGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHDFSSPPHLLRTPSGASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDSRRNKQQRIKEEGE Produced by alternative promoter usage. p63_mouse Tumor protein 63 Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like protein protein mouse Mus musculus Mouse MNFETSRCATLQYCPDPYIQRFIETPAHFSWKESYYRSAMSQSTQTSEFLSPEVFQHIWDFLEQPICSVQPIELNFVDEPSENGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSMQSQSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTMPEGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHDFSSPPHLLRTPSGASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDSRRNKQQRIKEEGE p63_human Tumor protein 63 TP63 KET P63 P73H P73L TP73L Transformation-related protein 63 Tumor protein p73-like p51 p40 Keratinocyte transcription factor KET Chronic ulcerative stomatitis protein protein protein human Homo sapiens Human MNFETSRCATLQYCPDPYIQRFVETPAHFSWKESYYRSTMSQSTQTNEFLSPEVFQHIWDFLEQPICSVQPIDLNFVDEPSEDGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSTKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSIQSPSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTIPDGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHEFSSPSHLLRTPSSASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDARRNKQQRIKEEGE tp63-1 1131679 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. Fig. 1A tp63-20 1131679 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. Fig. 1B tp63-tp63-1 1131679 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false Supp. Fig. 1A tp63-2 1131679 n/a 1131689 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) n/a 1131689 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. Fig. 1C tp63-tp63-2 1131679 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false Supp. Fig. 1B tp63-1 1131679 n/a 1131690 unspecified role unspecified role neutral component neutral component c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false Supp. Fig. 1D tp63-2 1131679 n/a 1131690 unspecified role unspecified role neutral component neutral component c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) n/a 1131690 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. Fig. 1D p21-tp63 1131680 n/a 1131691 unspecified role unspecified role neutral component neutral component n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false 1131680 Fig. 3a p21-tp63-1 1131680 n/a 1131691 unspecified role unspecified role neutral component neutral component n/a 1131689 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 direct interaction direct interaction false false false 1131680 Fig. 3B cctattctagaca-tp63-1 1131680 n/a 1131692 unspecified role unspecified role neutral component neutral component n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false O88898-1:p.Arg318His mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1131680 Supp. Fig. 3a cctattctagaca-tp63-2 1131680 n/a 1131692 unspecified role unspecified role neutral component neutral component n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 direct interaction direct interaction false false false 1131680 Supp. Fig. 3A p21-tp63-2 1131680 n/a 1131691 unspecified role unspecified role neutral component neutral component n/a 1131690 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false n_terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 direct interaction direct interaction false false false 1131680 Fig. 3C cctattctagacatg-tp63 1131680 n/a 1131690 unspecified role unspecified role neutral component neutral component c-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false n_terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 n/a 1131692 unspecified role unspecified role neutral component neutral component direct interaction direct interaction false false false 1131680 Supp. Fig. 3A p63 1131681 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 2.0 direct interaction direct interaction false false false Fig. 1B, S2A tp63-2 1131681 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 2.0 direct interaction direct interaction false false false Fig. 1B, S2A tp63-1 1131681 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 1B, S2A tp63-tp63 1131681 n/a 1131690 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 1B, S2A tp63-7 1131681 n/a 1131693 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 6A p63-1 1131682 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 1F tp63-1 1131682 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 2.0 direct interaction direct interaction false false false Fig. 1E tp63-1 1131682 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 2.0 direct interaction direct interaction false false false Fig. 1D p63-1 1131682 n/a 1131689 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 1F tp63 1131682 n/a 1131690 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 1G tp63-3 1131683 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false Stoichiometry: 2.0 direct interaction direct interaction false false false Supp. Figs. 1F, 1G, Table 1 A small peak indicating tetrameric protein was also observed. tp63-3 1131683 n/a 1131689 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false Stoichiometry: 4.0 direct interaction direct interaction false false false Supp. Figs. 1F, 1G, Table 1 tp63-3 1131683 n/a 1131690 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false Stoichiometry: 4.0 direct interaction direct interaction false false false Supp. Figs. 1F, 1H, Table 1 tp63-tp63-3 1131684 n/a 1131689 unspecified role unspecified role prey prey n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false O88898-1:p.[Met413Gln;Ile417Arg] mutation increasing mutation increasing interaction mutation increasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes n/a 1131689 unspecified role unspecified role bait bait transactivation inhibition region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Fig. 5F Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-tp63-5 1131684 n/a 1131690 unspecified role unspecified role prey prey c_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes n/a 1131689 unspecified role unspecified role bait bait transactivation inhibition region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Fig. 5F Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-tp63-6 1131684 n/a 1131689 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false transactivation activation region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) n/a 1131689 unspecified role unspecified role prey prey O88898-1:p.[Phe55Ala;Trp59Ala;Leu62Ala] mutation increasing mutation increasing interaction mutation increasing certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false O88898-1:p.[Met413Gln;Ile417Arg] mutation increasing mutation increasing interaction mutation increasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes direct interaction direct interaction false false false Fig. 5H, 5I, 6I, 6J Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-3 1131685 n/a 1131694 unspecified role unspecified role neutral component neutral component Stoichiometry: 2.0 direct interaction direct interaction false false false Figs 2A 0 tp63-3 1131685 n/a 1131694 unspecified role unspecified role neutral component neutral component Stoichiometry: 4.0 direct interaction direct interaction false false false Figs 2A, 2D, 2E, 3d 0.52 lambda-phosphatase-treated TAp63alpha obtained from irradiated oocytes showed a high percentage of tetramers and only a relatively small increase in the dimer concentration compared with phosphorylated TAp63alpha tp63-3 1131686 n/a 1131689 unspecified role unspecified role neutral component neutral component n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 4A, 4E, 6G, 6H Supp. Fig. 5A Mutants met413gln/ile417arg cause the protein to become a dimer. The phe55ala/trp23ala/leu62ala (FWL) mutation results in the formation of tetramers. TAp63aFWL behaves similar to DeltaNp63α, which lacks the N-terminal part of the TA domain. tp63-3 1131686 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain false rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes Stoichiometry: 4.0 direct interaction direct interaction false false false Fig. 4C, 4G Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-2 1131687 n/a 1131689 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 2.0 direct interaction direct interaction false false false Supp. Fig. 1E A small peak indicating tetrameric protein was also observed. tp63-tp63-7 1131688 n/a 1131695 unspecified role unspecified role neutral component neutral component Q9H3D4:p.[Phe55Ala;Trp59Ala;Leu62Ala] mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1131695 unspecified role unspecified role neutral component neutral component region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) 1131864 1131861 direct interaction direct interaction false false false Fig. 6B-D