IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Mechanism of vitamin D3-induced transcription of phospholipase D1 in HaCat human keratinocytes. Mechanism of vitamin D3-induced transcription of phospholipase D1 in HaCat human keratinocytes. FEBS Lett. (0014-5793) 2007 imex curation Kikuchi R., Sobue S., Murakami M., Ito H., Kimura A., Iwasaki T., Shibayama S., Takagi A., Kojima T., Suzuki M., Banno Y., Nozawa Y., Murate T. IBD - Inflammatory bowel disease murate@met.nagoya-u.ac.jp 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hacat Homo sapiens immortalised keratinocytes hacat human immortalised keratinocytes ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Kikuchi R., Sobue S., Murakami M., Ito H., Kimura A., Iwasaki T., Shibayama S., Takagi A., Kojima T., Suzuki M., Banno Y., Nozawa Y., Murate T. IBD - Inflammatory bowel disease murate@met.nagoya-u.ac.jp Accepted 2014-NOV-12 by ORCHARD FEBS Lett. (0014-5793) 2007 Only protein-protein interactions imex curation Mechanism of vitamin D3-induced transcription of phospholipase D1 in HaCat human keratinocytes. Mechanism of vitamin D3-induced transcription of phospholipase D1 in HaCat human keratinocytes. FEBS Lett. (0014-5793) 2007 imex curation Kikuchi R., Sobue S., Murakami M., Ito H., Kimura A., Iwasaki T., Shibayama S., Takagi A., Kojima T., Suzuki M., Banno Y., Nozawa Y., Murate T. IBD - Inflammatory bowel disease murate@met.nagoya-u.ac.jp 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift anti tag immunost anti tag immunostaining anti tag immunost Kikuchi R., Sobue S., Murakami M., Ito H., Kimura A., Iwasaki T., Shibayama S., Takagi A., Kojima T., Suzuki M., Banno Y., Nozawa Y., Murate T. IBD - Inflammatory bowel disease Nuclear extracts for this experiment were prepared from HaCaT cells treated with VitD3 (CHEBI:17823) for 48 hours. The method is described in more detail in PMID:16964281 and PMID:16135093. murate@met.nagoya-u.ac.jp Accepted 2014-NOV-12 by ORCHARD FEBS Lett. (0014-5793) 2007 Only protein-protein interactions imex curation pld1_human_gene Phospholipase D1 (PLD1) human gene gene gene human Homo sapiens Human pld1_human_vdre-site_dna-probe Human PLD1 gene promoter vitamin D responsive element DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CCCTAGGGTGATGCGGTCGAGTTATG rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT DIP protein P19793 original sequence version: 177 DIP protein P19793 original sequence version: 107 DIP protein P19793 original sequence version: 153 DIP protein P19793 original sequence version: 131 DIP protein P19793 original sequence version: 136 DIP protein P19793 original sequence version: 169 DIP protein P19793 original sequence version: 161 DIP protein P19793 original sequence version: 139 7F952B580AD84C42 vdr_human Vitamin D3 receptor 1,25-dihydroxyvitamin D3 receptor Nuclear receptor subfamily 1 group I member 1 VDR NR1I1 protein protein human Homo sapiens Human MEAMAASTSLPDPGDFDRNVPRICGVCGDRATGFHFNAMTCEGCKGFFRRSMKRKALFTCPFNGDCRITKDNRRHCQACRLKRCVDIGMMKEFILTDEEVQRKREMILKRKEEEALKDSLRPKLSEEQQRIIAILLDAHHKTYDPTYSDFCQFRPPVRVNDGGGSHPSRPNSRHTPSFSGDSSSSCSDHCITSSDMMDSSSFSNLDLSEEDSDDPSVTLELSQLSMLPHLADLVSYSIQKVIGFAKMIPGFRDLTSEDQIVLLKSSAIEVIMLRSNESFTMDDMSWTCGNQDYKYRVSDVTKAGHSLELIEPLIKFQVGLKKLNLHEEEHVLLMAICIVSPDRPGVQDAALIEAIQDRLSNTLQTYIRCRHPPPGSHLLYAKMIQKLADLRSLNEEHSKQYRCLSFQPECSMKLTPLVLEVFGNEIS DIP protein P11473 original sequence version: 179 DIP protein P11473 original sequence version: 146 F95F300D042C4CB7 vdr-pld1-1 1 3 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait association association Fig. 4a Vitamine D3 (1alpha,25(OH)2D3), the active metabolite of vitamin D (CHEBI:17823, calcitriol) No PLD1 promoter DNA was co-precipitated with anti-VDR antibody from cells not treated with VitD3. P11473 increases expression at RNA level of ENSG00000075651 CHEBI:17823 increases binding of P11473 to ENSG00000075651 rxra-pld1-1 1 3 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role bait bait association association Fig. 4a Vitamine D3 (1alpha,25(OH)2D3), the active metabolite of vitamin D (CHEBI:17823, calcitriol) No PLD1 promoter DNA was co-precipitated with anti-RXRalpha antibody from cells not treated with VitD3. CHEBI:17823 increases binding of P19793 to ENSG00000075651 pld1-vdr-1 2 6 unspecified role unspecified role prey prey human-hacat Homo sapiens immortalised keratinocytes hacat human immortalised keratinocytes 4 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3d pld1-rxra-1 2 5 unspecified role unspecified role prey prey human-hacat Homo sapiens immortalised keratinocytes hacat human immortalised keratinocytes 4 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3d